@article{93a61e650a23425caff0da51d03fc825,
title = "Correction to: Gene mutation spectrum and genotype-phenotype correlation in a cohort of Chinese osteogenesis imperfecta patients revealed by targeted next generation sequencing (Osteoporos Int, 10.1007/s00198-017-4143-8)",
abstract = "In Table 2: Family 6 should be c.643-13_662delCTATCTTTTCTAGGGTCCCATGGGTCCCCGAGG instead of c.643-13_662delCTATCTTTTCTAGGGTCCCATGGGTCCCC. Family 33 should be c.271_279dupGCCCTCTCG instead of c.271_279dupGCCCTCT. In the 2nd para. of the Molecular diagnosis, section t(5;8)(q32;q21) should be t(5;7)(q32;q21).",
author = "Y. Liu and Asan and D. Ma and F. Lv and X. Xu and J. Wang and W. Xia and Y. Jiang and O. Wang and X. Xing and W. Yu and J. Wang and J. Sun and L. Song and Y. Zhu and H. Yang and J. Wang and M. Li",
note = "Publisher Copyright: {\textcopyright} 2017, International Osteoporosis Foundation and National Osteoporosis Foundation.",
year = "2018",
month = jan,
day = "1",
doi = "10.1007/s00198-017-4250-6",
language = "English",
volume = "29",
pages = "261",
journal = "Osteoporosis International",
issn = "0937-941X",
publisher = "Springer Science and Business Media Deutschland GmbH",
number = "1",
}