Correction to: Gene mutation spectrum and genotype-phenotype correlation in a cohort of Chinese osteogenesis imperfecta patients revealed by targeted next generation sequencing (Osteoporos Int, 10.1007/s00198-017-4143-8)

Y. Liu; Asan; D. Ma; F. Lv; X. Xu; J. Wang; W. Xia; Y. Jiang; O. Wang; X. Xing; W. Yu; J. Wang; J. Sun; L. Song; Y. Zhu; H. Yang; J. Wang; M. Li

doi:10.1007/s00198-017-4250-6

Correction to: Gene mutation spectrum and genotype-phenotype correlation in a cohort of Chinese osteogenesis imperfecta patients revealed by targeted next generation sequencing (Osteoporos Int, 10.1007/s00198-017-4143-8)

Y. Liu, Asan, D. Ma, F. Lv, X. Xu, J. Wang, W. Xia, Y. Jiang, O. Wang, X. Xing, W. Yu, J. Wang, J. Sun, L. Song, Y. Zhu, H. Yang, J. Wang, M. Li^*

^*Corresponding author for this work

Research output: Contribution to journal › Comment/debate

Abstract

In Table 2: Family 6 should be c.643-13_662delCTATCTTTTCTAGGGTCCCATGGGTCCCCGAGG instead of c.643-13_662delCTATCTTTTCTAGGGTCCCATGGGTCCCC. Family 33 should be c.271_279dupGCCCTCTCG instead of c.271_279dupGCCCTCT. In the 2nd para. of the Molecular diagnosis, section t(5;8)(q32;q21) should be t(5;7)(q32;q21).

Original language	English
Pages (from-to)	261
Number of pages	1
Journal	Osteoporosis International
Volume	29
Issue number	1
DOIs	https://doi.org/10.1007/s00198-017-4250-6
Publication status	Published - 1 Jan 2018
Externally published	Yes

UN SDGs

This output contributes to the following UN Sustainable Development Goals (SDGs)

Access to Document

10.1007/s00198-017-4250-6

Fingerprint

Dive into the research topics of 'Correction to: Gene mutation spectrum and genotype-phenotype correlation in a cohort of Chinese osteogenesis imperfecta patients revealed by targeted next generation sequencing (Osteoporos Int, 10.1007/s00198-017-4143-8)'. Together they form a unique fingerprint.

Cite this

Liu, Y., Asan, Ma, D., Lv, F., Xu, X., Wang, J., Xia, W., Jiang, Y., Wang, O., Xing, X., Yu, W., Wang, J., Sun, J., Song, L., Zhu, Y., Yang, H., Wang, J., & Li, M. (2018). Correction to: Gene mutation spectrum and genotype-phenotype correlation in a cohort of Chinese osteogenesis imperfecta patients revealed by targeted next generation sequencing (Osteoporos Int, 10.1007/s00198-017-4143-8). Osteoporosis International, 29(1), 261. https://doi.org/10.1007/s00198-017-4250-6

@article{93a61e650a23425caff0da51d03fc825,

title = "Correction to: Gene mutation spectrum and genotype-phenotype correlation in a cohort of Chinese osteogenesis imperfecta patients revealed by targeted next generation sequencing (Osteoporos Int, 10.1007/s00198-017-4143-8)",

abstract = "In Table 2: Family 6 should be c.643-13_662delCTATCTTTTCTAGGGTCCCATGGGTCCCCGAGG instead of c.643-13_662delCTATCTTTTCTAGGGTCCCATGGGTCCCC. Family 33 should be c.271_279dupGCCCTCTCG instead of c.271_279dupGCCCTCT. In the 2nd para. of the Molecular diagnosis, section t(5;8)(q32;q21) should be t(5;7)(q32;q21).",

author = "Y. Liu and Asan and D. Ma and F. Lv and X. Xu and J. Wang and W. Xia and Y. Jiang and O. Wang and X. Xing and W. Yu and J. Wang and J. Sun and L. Song and Y. Zhu and H. Yang and J. Wang and M. Li",

note = "Publisher Copyright: {\textcopyright} 2017, International Osteoporosis Foundation and National Osteoporosis Foundation.",

year = "2018",

month = jan,

day = "1",

doi = "10.1007/s00198-017-4250-6",

language = "English",

volume = "29",

pages = "261",

journal = "Osteoporosis International",

issn = "0937-941X",

publisher = "Springer London",

number = "1",

}

Liu, Y, Asan, Ma, D, Lv, F, Xu, X, Wang, J, Xia, W, Jiang, Y, Wang, O, Xing, X, Yu, W, Wang, J, Sun, J, Song, L, Zhu, Y, Yang, H, Wang, J & Li, M 2018, 'Correction to: Gene mutation spectrum and genotype-phenotype correlation in a cohort of Chinese osteogenesis imperfecta patients revealed by targeted next generation sequencing (Osteoporos Int, 10.1007/s00198-017-4143-8)', Osteoporosis International, vol. 29, no. 1, pp. 261. https://doi.org/10.1007/s00198-017-4250-6

Correction to: Gene mutation spectrum and genotype-phenotype correlation in a cohort of Chinese osteogenesis imperfecta patients revealed by targeted next generation sequencing (Osteoporos Int, 10.1007/s00198-017-4143-8). / Liu, Y.; Asan; Ma, D. et al.
In: Osteoporosis International, Vol. 29, No. 1, 01.01.2018, p. 261.

Research output: Contribution to journal › Comment/debate

TY - JOUR

T1 - Correction to

T2 - Gene mutation spectrum and genotype-phenotype correlation in a cohort of Chinese osteogenesis imperfecta patients revealed by targeted next generation sequencing (Osteoporos Int, 10.1007/s00198-017-4143-8)

AU - Liu, Y.

AU - Asan,

AU - Ma, D.

AU - Lv, F.

AU - Xu, X.

AU - Wang, J.

AU - Xia, W.

AU - Jiang, Y.

AU - Wang, O.

AU - Xing, X.

AU - Yu, W.

AU - Wang, J.

AU - Sun, J.

AU - Song, L.

AU - Zhu, Y.

AU - Yang, H.

AU - Wang, J.

AU - Li, M.

PY - 2018/1/1

Y1 - 2018/1/1

N2 - In Table 2: Family 6 should be c.643-13_662delCTATCTTTTCTAGGGTCCCATGGGTCCCCGAGG instead of c.643-13_662delCTATCTTTTCTAGGGTCCCATGGGTCCCC. Family 33 should be c.271_279dupGCCCTCTCG instead of c.271_279dupGCCCTCT. In the 2nd para. of the Molecular diagnosis, section t(5;8)(q32;q21) should be t(5;7)(q32;q21).

AB - In Table 2: Family 6 should be c.643-13_662delCTATCTTTTCTAGGGTCCCATGGGTCCCCGAGG instead of c.643-13_662delCTATCTTTTCTAGGGTCCCATGGGTCCCC. Family 33 should be c.271_279dupGCCCTCTCG instead of c.271_279dupGCCCTCT. In the 2nd para. of the Molecular diagnosis, section t(5;8)(q32;q21) should be t(5;7)(q32;q21).

UR - http://www.scopus.com/inward/record.url?scp=85032896051&partnerID=8YFLogxK

U2 - 10.1007/s00198-017-4250-6

DO - 10.1007/s00198-017-4250-6

M3 - Comment/debate

C2 - 29098346

AN - SCOPUS:85032896051

SN - 0937-941X

VL - 29

SP - 261

JO - Osteoporosis International

JF - Osteoporosis International

IS - 1

ER -

Correction to: Gene mutation spectrum and genotype-phenotype correlation in a cohort of Chinese osteogenesis imperfecta patients revealed by targeted next generation sequencing (Osteoporos Int, 10.1007/s00198-017-4143-8)

Abstract

UN SDGs

Access to Document

Other files and links

Fingerprint

Cite this