Correction to: Gene mutation spectrum and genotype-phenotype correlation in a cohort of Chinese osteogenesis imperfecta patients revealed by targeted next generation sequencing (Osteoporos Int, 10.1007/s00198-017-4143-8)

  • Y. Liu
  • , Asan
  • , D. Ma
  • , F. Lv
  • , X. Xu
  • , J. Wang
  • , W. Xia
  • , Y. Jiang
  • , O. Wang
  • , X. Xing
  • , W. Yu
  • , J. Wang
  • , J. Sun
  • , L. Song
  • , Y. Zhu
  • , H. Yang
  • , J. Wang
  • , M. Li*
  • *Corresponding author for this work

Research output: Contribution to journalComment/debate

Abstract

In Table 2: Family 6 should be c.643-13_662delCTATCTTTTCTAGGGTCCCATGGGTCCCCGAGG instead of c.643-13_662delCTATCTTTTCTAGGGTCCCATGGGTCCCC. Family 33 should be c.271_279dupGCCCTCTCG instead of c.271_279dupGCCCTCT. In the 2nd para. of the Molecular diagnosis, section t(5;8)(q32;q21) should be t(5;7)(q32;q21).

Original languageEnglish
Pages (from-to)261
Number of pages1
JournalOsteoporosis International
Volume29
Issue number1
DOIs
Publication statusPublished - 1 Jan 2018
Externally publishedYes

Fingerprint

Dive into the research topics of 'Correction to: Gene mutation spectrum and genotype-phenotype correlation in a cohort of Chinese osteogenesis imperfecta patients revealed by targeted next generation sequencing (Osteoporos Int, 10.1007/s00198-017-4143-8)'. Together they form a unique fingerprint.

Cite this